version
PlantPromoterDB promoter information of 006-103-F09

Summary of Gene (006-103-F09)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0180900        NCBI 
Gene model 006-103-F09  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 4294326-4295525)

Genome position     
from initiation codon
006-055-B11         
011-009-E03         
011-035-H08         
014-043-F08         
AK060711            
AK060963            
AK104447            
AK104504            
AK104629            
J023003P15          
J023075H14          
J033101N17          
J033132M11          
J065081C24          
J090008I06          
J100058N20          
J100060M07          
J100062M08          
J100064L07          
J100073H16          
J100074C10          
J100075N06          
J100087P11          
J100088B13          
J100088J16          
J100088L17          
TSS from cDNA
TSS information
006-103-F09                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-103-F09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+4295324-2
TSS clone peakAclone+4295325-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCACCTATATAAC+42952894295300-37-26
Y PatchCCTCTCTCCC+42953004295309-26-17
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATATGGGCCAA+42951064295116-220-210
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGAACTGGGC+42951404295147-186-179
 OsREG425AACTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGACGGCCCATCT+42951624295173-164-153
 OsREG584GACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456    GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCAGCCCA+42951844295197-142-129
 OsREG497CAAGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG473  AGGCCCAG     PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GCCCAGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG533     CCCAGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG523      CCAGCCCA PPDB MotifGCCCA  PLACE Motif 
REGTCCACGCC+42952144295221-112-105
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGGGTCCAGA+42952394295246-87-80
 OsREG649GGTCCAGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.