version
PlantPromoterDB promoter information of 006-104-B12

Summary of Gene (006-104-B12)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0636900        NCBI 
Gene model 006-104-B12  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 32785753-32784554)

Genome position     
from initiation codon
009-009-D04         
009-010-G07         
009-048-H10         
013-066-B10         
014-093-G08         
015-025-C07         
AK064789            
AK104813            
J013000C05          
J013043J05          
J013058C15          
J013058E15          
J013072N16          
J013102O16          
J090060K17          
J090069E22          
J100030G19          
J100050F15          
J100050L20          
J100054F18          
J100083P05          
TSS from cDNA
TSS information
006-104-B12                      5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-104-B12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-32785591J100030G19, J100050F15, J100050L20, J100083P05, J100054F18, 013-066-B10, J013072N16, J013058C15, J013058E15, J013102O16, J090069E22, 009-010-G07, 014-093-G08, 009-009-D04, 009-048-H10, 015-025-C07

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCCTCTC-3278555432785564009-009-D04, 009-010-G07, 009-048-H10, 013-066-B10, 014-093-G08, 015-025-C07, J013058C15, J013058E15, J013072N16, J013102O16, J090069E22, J100030G19, J100050F15, J100050L20, J100054F18, J100083P05
Y PatchCCCCTTCCTCCTCT-3278557332785586009-009-D04, 009-010-G07, 009-048-H10, 013-066-B10, 014-093-G08, 015-025-C07, J013058C15, J013058E15, J013072N16, J013102O16, J090069E22, J100030G19, J100050F15, J100050L20, J100054F18, J100083P05
Y PatchTCCTCCTCTCTCTCTCTCT-3278561932785637009-009-D04, 009-010-G07, 009-048-H10, 013-066-B10, 014-093-G08, 015-025-C07, J013058C15, J013058E15, J013072N16, J013102O16, J090069E22, J100030G19, J100050F15, J100050L20, J100054F18, J100083P05
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCCCACCAC-3278567632785684009-009-D04, 009-010-G07, 009-048-H10, 013-066-B10, 014-093-G08, 015-025-C07, J013058C15, J013058E15, J013072N16, J013102O16, J090069E22, J100030G19, J100050F15, J100050L20, J100054F18, J100083P05
 OsREG599GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527 CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCGGCCCGGT-3278569432785702009-009-D04, 009-010-G07, 009-048-H10, 013-066-B10, 014-093-G08, 015-025-C07, J013058C15, J013058E15, J013072N16, J013102O16, J090069E22, J100030G19, J100050F15, J100050L20, J100054F18, J100083P05
 OsREG544CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG441 GGCCCGGT PPDB Motif  PLACE Motif 
REGTCCACGCCTC-3278574132785750009-009-D04, 009-010-G07, 009-048-H10, 013-066-B10, 014-093-G08, 015-025-C07, J013058C15, J013058E15, J013072N16, J013102O16, J090069E22, J100030G19, J100050F15, J100050L20, J100054F18, J100083P05
 OsREG636TCCACGCC   PPDB Motif  PLACE Motif 
 OsREG503  CACGCCTC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.