version
PlantPromoterDB promoter information of 006-109-D02

Summary of Gene (006-109-D02)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0577600        NCBI 
Gene model 006-109-D02  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 24018083-24019282)

Genome position     
from initiation codon
006-021-H11         
006-022-B11         
006-022-D10         
006-022-E02         
006-022-F03         
006-023-C11         
006-024-C10         
006-024-C12         
006-024-G12         
006-026-C04         
006-026-E05         
006-026-E11         
006-026-F09         
006-026-H05         
006-027-D03         
006-028-C04         
006-029-G10         
006-030-A11         
006-030-D12         
006-031-G05         
006-032-H06         
006-033-A02         
006-033-A06         
006-034-B10         
006-034-F07         
006-035-A08         
006-035-F07         
006-036-A04         
006-036-B04         
006-037-D02         
006-037-F12         
006-037-H12         
006-040-G12         
006-040-H03         
006-040-H06         
006-042-B12         
006-042-H10         
006-044-G09         
006-045-C04         
006-046-B10         
006-047-A05         
006-048-D05         
006-049-A08         
006-050-C07         
006-050-H10         
006-051-G03         
006-052-A01         
006-052-A05         
006-052-B03         
006-052-D10         
006-054-D03         
006-055-A12         
006-055-C05         
006-055-F05         
006-055-H10         
006-056-A02         
006-056-D07         
006-057-A03         
006-057-B06         
006-057-H08         
006-058-C04         
006-058-F06         
006-059-C10         
006-059-G08         
006-060-E10         
006-061-B10         
006-062-A05         
006-062-B04         
006-063-A04         
006-063-D01         
006-063-G12         
006-064-D12         
006-066-A03         
006-066-C03         
006-067-A03         
006-067-G07         
006-068-A06         
006-069-D04         
006-069-G05         
006-070-H08         
006-071-A05         
006-071-H11         
006-072-A07         
006-072-B02         
006-072-D11         
006-072-H12         
006-075-G06         
006-077-B09         
006-078-D01         
006-078-D02         
006-078-E05         
006-078-G07         
006-079-C03         
006-079-F12         
006-079-H01         
006-080-D04         
006-080-H04         
006-081-A10         
006-082-G02         
006-082-H07         
006-083-B03         
006-085-A09         
006-085-A12         
006-085-F07         
006-086-B11         
006-086-D01         
006-086-G04         
006-087-E04         
006-087-G09         
006-088-E11         
006-088-G10         
006-088-H01         
006-089-B04         
006-089-D05         
006-089-F07         
006-089-H07         
006-090-B06         
006-090-H05         
006-091-E11         
006-092-H01         
006-093-B08         
006-093-C07         
006-093-F02         
006-093-G05         
006-093-G06         
006-094-D10         
006-094-H07         
006-095-G03         
006-096-A06         
006-096-E03         
006-097-B03         
006-097-D03         
006-098-B07         
006-098-G05         
006-099-F05         
006-100-H10         
006-100-H12         
006-101-A06         
006-101-A08         
006-101-A12         
006-101-D04         
006-101-G07         
006-102-B12         
006-102-E09         
006-102-F02         
006-103-D09         
006-105-D05         
006-105-D08         
006-106-C07         
006-106-F12         
006-107-D01         
006-109-C05         
006-109-C08         
006-111-F03         
006-112-C12         
006-112-D08         
006-113-A01         
006-113-B03         
006-113-C11         
006-113-E07         
006-113-F08         
006-114-D08         
006-114-H08         
006-115-A08         
006-115-A09         
006-115-G05         
006-117-B06         
006-117-B09         
006-117-F11         
006-117-G10         
006-117-H08         
006-118-C06         
006-118-G11         
006-119-H03         
006-120-D01         
006-120-D12         
006-120-H04         
009-022-E12         
009-044-H02         
009-074-B08         
009-145-B08         
009-156-D09         
009-163-F03         
009-193-G03         
AF010321            
AK060987            
AK070051            
AK103966            
AK104016            
AK104127            
AK104177            
AK104283            
AK104608            
AK104651            
AK119176            
J065013J05          
J065129D23          
J065138E06          
J065179N22          
J065192A07          
J065208G16          
J075013K01          
J075017B12          
J075018O17          
J075023H05          
J075053L02          
J075067I01          
J075083D19          
J075083G03          
J075084F12          
J075088K18          
J075094A18          
J075094I22          
J075097E17          
J075098I24          
J075110K19          
J075118G21          
J075118J20          
J075120G14          
J075120H20          
J075127H23          
J075139M03          
J075142E17          
J075149N17          
J075152A20          
J075157N22          
J075159K21          
J075173B20          
J075192N20          
J075196A07          
J075199N04          
J080005P10          
J080025I24          
J080064D09          
J080064N24          
J080068B02          
J080097K04          
J080097K19          
J080097N20          
J100055P07          
TSS from cDNA
TSS information
006-109-D02                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-109-D02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+24017935-898
TSS clone peakCclone+24017946-887
TSS cloneGclone+24017949-884
TSS cloneAclone+24017950-883
TSS cloneAclone+24017953-880
TSS cloneCclone+24017955-878
TSS cloneAclone+24017956-877

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCTCGCCC+2401774124017748-1092-1085
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGGGCCCCACC+2401775924017769-1074-1064
 OsREG567CGGGCCCC    PPDB MotifACGGGC  PLACE Motif 
 OsREG641 GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631  GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612   GCCCCACC PPDB Motif  PLACE Motif 
REGCGCCACGTC+2401778524017793-1048-1040
 OsREG448CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGCGACGCG+2401783824017846-995-987
 OsREG556CGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGGCCCATCC+2401787824017885-955-948
 OsREG608GCCCATCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.