version
PlantPromoterDB promoter information of 006-113-G08

Summary of Gene (006-113-G08)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0229100        NCBI 
Gene model 006-113-G08  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 7128840-7127641)

Genome position     
from initiation codon
AK061285            
AK070838            
J013059F08          
J013059G08          
J013059G09          
J013069M12          
J013105A19          
J013149F07          
J023073J07          
J023130F24          
J023147J08          
J033028F13          
J033115A16          
J033135F02          
J065031G16          
J065058A09          
J065089N15          
J065130I09          
J065191P09          
J065197P14          
J080306D15          
J080308M06          
J080315A03          
J080315N11          
J090046E14          
J090058G09          
J090077H05          
J090087O20          
TSS from cDNA
TSS information
006-113-G08                      5'->3' (-)
Promoter sequence









 
011-044-A08         
AK066024            
J013032E21          
J013047G02          
J013097E19          
J013100E12          
J013106L15          
J013119H14          
J023024B05          
J023036P14          
J023069B19          
J023086O07          
J023108L15          
J023109G12          
J023113F22          
J023132C08          
J033024L10          
J033041N09          
J033064F03          
J033107D07          
J033124A20          
J033148J02          
J053058D11          
J065058O14          
J065142O14          
J090014F02          
J090031A11          
J100051H05          
J100064A05          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-113-G08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-7127879-39
TSS clone peakAclone-7127870-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCCTC-71278747127885-34-45
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCATTA-71279197127929-79-89
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGACGTGGGCCGAAA-71279347127946-94-106
 OsREG449ACGTGGGC      PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571 CGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG634     GGCCGAAA PPDB Motif  PLACE Motif 
REGCCAGGCCCATTTTGGCCCATAC-71279507127971-110-131
 OsREG524CCAGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG474  AGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT            PPDB MotifGCCCA  PLACE Motif 
 OsREG422    GCCCATTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG660           TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488            TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630             GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606              GCCCATAC PPDB MotifGCCCA  PLACE Motif 
REGACGTGGGCCTC-71279777127987-137-147
 OsREG449ACGTGGGC    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571 CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+7128216AK066024, AK066024

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAATGGGCCTC+71279197127929AK066024
 OsREG610TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGTTTCGGCCCACGT+71279347127946AK066024
 OsREG634TTTCGGCC      PPDB Motif  PLACE Motif 
 OsREG642 TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564   CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449     GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGGTATGGGCCAAAATGGGCCTGG+71279507127971AK066024
 OsREG606GTATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG422          AAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG431           AATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG474            ATGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG513             TGGGCCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG524              GGGCCTGG PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCACGT+71279777127987AK066024
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449   GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.