version
PlantPromoterDB promoter information of 006-115-E04

Summary of Gene (006-115-E04)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0525900        NCBI 
Gene model 006-115-E04  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 21385590-21384391)

Genome position     
from initiation codon
006-117-B02         
AK059988            
AK071290            
J013153K05          
J023087M04          
J065165B13          
J075002B09          
J075013G15          
J075021P14          
J075028A09          
J075031I06          
J075051C21          
J075058C07          
J075066C02          
J075092E24          
J075097M16          
J075114H22          
J075123N09          
J075129A19          
J075129M12          
J075135I24          
J075137A07          
J075142A04          
J075148G08          
J075149L20          
J075151A06          
J075151B05          
J075152E24          
J075166N24          
J075167M23          
J075168D10          
J075180N19          
J090026J17          
J090061B18          
J090064E20          
J090083P20          
J100037I03          
J100073I20          
TSS from cDNA
TSS information
006-115-E04                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-115-E04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-21384685-95
TSS clone peakGclone-21384668-78

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCCCTC-2138468621384695-96-105
Y PatchTCTCCTCTCCCTTCCTCCTCC-2138471021384730-120-140
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGGCCCACGC-2138474021384750-150-160
 OsREG647GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602   GCCCACGC PPDB MotifGCCCA  PLACE Motif 
REGCCCACGCG-2138477921384786-189-196
 OsREG530CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGCGCGGGGG-2138478921384796-199-206
 OsREG537CGCGGGGG PPDB Motif  PLACE Motif 
REGCAACGGCT-2138481021384817-220-227
 OsREG469CAACGGCT PPDB MotifCCAACGG  PLACE Motif 
REGCGCGTCGCG-2138494621384954-356-364
 OsREG559CGCGTCGC  PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG PPDB Motif  PLACE MotifCGACG 
REGGCCACACG-2138497821384985-388-395
 OsREG573GCCACACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.