version
PlantPromoterDB promoter information of 006-117-H03

Summary of Gene (006-117-H03)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0625000        NCBI 
Gene model 006-117-H03  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 26930315-26929116)

Genome position     
from initiation codon
006-057-H11         
006-107-G01         
AF073695            
AK061993            
AK099598            
J013045K17          
J013119J05          
J013155O09          
J033071N14          
J053031L01          
J090030D04          
J090084L13          
J100049C06          
J100060O11          
TSS from cDNA
TSS information
006-117-H03                      5'->3' (-)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-117-H03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-26929538-223

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTGTATAAAAC-2692956426929574-249-259
Y PatchCTTCCTCCTCC-2692953926929549-224-234
Y PatchCCCTTCCTCCTCTCCT-2692957326929588-258-273
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGGACC-2692961626929623-301-308
 OsREG570CGTGGACC PPDB Motif  PLACE Motif 
REGAGTGACAC-2692963126929638-316-323
 OsREG477AGTGACAC PPDB Motif  PLACE MotifTGAC 
REGTGCGGGCCCCACCTG-2692964026929654-325-339
 OsREG632TGCGGGCC        PPDB Motif  PLACE Motif 
 OsREG619 GCGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG567  CGGGCCCC      PPDB MotifACGGGC  PLACE Motif 
 OsREG641   GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG514       CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGGGTCCACG-2692968026929687-365-372
 OsREG570GGTCCACG PPDB Motif  PLACE Motif 
REGGGCCGTCC-2692971226929719-397-404
 OsREG624GGCCGTCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.