PlantPromoterDB promoter information of 009-006-H12

Summary of Gene (009-006-H12)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0121000        NCBI 
Gene model 009-006-H12  
Description NONE  


Focused view (chromosome 5: 1093742-1094941)

Genome position     
from initiation codon
TSS from cDNA
TSS information
009-006-H12                      5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


Promoter Summary of 009-006-H12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakGclone+1093820AK071341, J053031K22, J053046I01, J053070B05, J053072C10, J065164I17, J100075J19, J043027A08, AK071341, J023090B22, J023111G15, J023134K14, J033084L15, J033088B04, 009-181-E02, J033067J15, J080304C16, J080304H16, J080306E17, J080310L03, J080316J07, J080317L23, J080319A10, J075058I08, J075064C09, J090060F01, J033057C05, J043029L03, J065097M22, J023024H24, J100042N16, J100047F05, AK058867
TSS clone peakTclone+1093910AK071341, J053031K22, J053046I01, J053070B05, J053072C10, J065164I17, J100075J19, J043027A08, AK071341, J023090B22, J023111G15, J023134K14, J033084L15, J033088B04, 009-181-E02, J033067J15, J080304C16, J080304H16, J080306E17, J080310L03, J080316J07, J080317L23, J080319A10, J075058I08, J075064C09, J090060F01, J033057C05, J043029L03, J065097M22, J023024H24, J100042N16, J100047F05, AK058867

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGTATAAATC+10937861093796009-181-E02, AK058867, AK071341, J023024H24, J023090B22, J023111G15, J023134K14, J033057C05, J033067J15, J033084L15, J033088B04, J043027A08, J043029L03, J053031K22, J053046I01, J053070B05, J053072C10, J065097M22, J065164I17, J075058I08, J075064C09, J080304C16, J080304H16, J080306E17, J080310L03, J080316J07, J080317L23, J080319A10, J090060F01, J100042N16, J100047F05, J100075J19
Y PatchCCCCTCCTCCTCCT+10939111093924009-181-E02, AK058867, AK071341, J023024H24, J023090B22, J023111G15, J023134K14, J033057C05, J033067J15, J033084L15, J033088B04, J043027A08, J043029L03, J053031K22, J053046I01, J053070B05, J053072C10, J065097M22, J065164I17, J075058I08, J075064C09, J080304C16, J080304H16, J080306E17, J080310L03, J080316J07, J080317L23, J080319A10, J090060F01, J100042N16, J100047F05, J100075J19

REG information

TypeSequenceAnnotationGenome positionGene model
REGAGGCCCAGG+10937351093743009-181-E02, AK058867, AK071341, J023024H24, J023090B22, J023111G15, J023134K14, J033057C05, J033067J15, J033084L15, J033088B04, J043027A08, J043029L03, J053031K22, J053046I01, J053070B05, J053072C10, J065097M22, J065164I17, J075058I08, J075064C09, J080304C16, J080304H16, J080306E17, J080310L03, J080316J07, J080317L23, J080319A10, J090060F01, J100042N16, J100047F05, J100075J19
REGGTTTGGGCCCACTAGGCCCAACC+10937531093775009-181-E02, AK058867, AK071341, J023024H24, J023090B22, J023111G15, J023134K14, J033057C05, J033067J15, J033084L15, J033088B04, J043027A08, J043029L03, J053031K22, J053046I01, J053070B05, J053072C10, J065097M22, J065164I17, J075058I08, J075064C09, J080304C16, J080304H16, J080306E17, J080310L03, J080316J07, J080317L23, J080319A10, J090060F01, J100042N16, J100047F05, J100075J19
 OsREG593GTTTGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG478     GGCCCACT           PPDB MotifGCCCA  PLACE Motif 
 OsREG656            TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471             AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626              GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595               GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGGCGGAGAG+10938591093866009-181-E02, AK058867, AK071341, J023024H24, J023090B22, J023111G15, J023134K14, J033057C05, J033067J15, J033084L15, J033088B04, J043027A08, J043029L03, J053031K22, J053046I01, J053070B05, J053072C10, J065097M22, J065164I17, J075058I08, J075064C09, J080304C16, J080304H16, J080306E17, J080310L03, J080316J07, J080317L23, J080319A10, J090060F01, J100042N16, J100047F05, J100075J19

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.