version
PlantPromoterDB promoter information of 009-006-H12

Summary of Gene (009-006-H12)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0121000        NCBI 
Gene model 009-006-H12  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 1094142-1095341)

Genome position     
from initiation codon
009-181-E02         
AK058867            
AK071341            
J023024H24          
J023090B22          
J023111G15          
J023134K14          
J033057C05          
J033067J15          
J033084L15          
J033088B04          
J043027A08          
J043029L03          
J053031K22          
J053046I01          
J053070B05          
J053072C10          
J065097M22          
J065164I17          
J075058I08          
J075064C09          
J080304C16          
J080304H16          
J080306E17          
J080310L03          
J080316J07          
J080317L23          
J080319A10          
J090060F01          
J100042N16          
J100047F05          
J100075J19          
TSS from cDNA
TSS information
009-006-H12                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-006-H12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.