version
PlantPromoterDB promoter information of 009-009-A08

Summary of Gene (009-009-A08)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0139700        NCBI 
Gene model 009-009-A08  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 2082636-2083835)

Genome position     
from initiation codon
006-052-C07         
015-020-D09         
015-087-H06         
016-078-A03         
AK067884            
AK103245            
AK106116            
AK106220            
TSS from cDNA
TSS information
009-009-A08                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-009-A08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+2083593-43
TSS clone peakAclone+2083597-39
TSS cloneGclone+2083601-35

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACGTC+20833322083339-304-297
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCGGCCC+20833462083353-290-283
 OsREG615GCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCCATGGGCCAAGGCCCATT+20834882083506-148-130
 OsREG525CCATGGGC            PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517 CATGGGCC           PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488  ATGGGCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA         PPDB MotifGCCCA  PLACE Motif 
 OsREG497        CAAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG430         AAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG474          AGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG431           GGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCATCCACC+20835232083536-113-100
 OsREG655TAAGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT      PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC     PPDB MotifGCCCA  PLACE Motif 
 OsREG608   GCCCATCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG534    CCCATCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG515      CATCCACC PPDB Motif  PLACE Motif 
REGAAAGCCCAAAC+20835412083551-95-85
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.