version
PlantPromoterDB promoter information of 009-015-H10

Summary of Gene (009-015-H10)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0645300        NCBI 
Gene model 009-015-H10  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 27459428-27460627)

Genome position     
from initiation codon
003-107-E03         
006-108-C01         
009-020-G11         
009-047-F04         
009-053-A12         
009-059-B03         
009-067-A06         
009-084-C03         
009-108-G09         
009-122-G05         
009-124-D08         
009-136-C07         
013-049-E07         
014-056-G04         
AK062126            
AK120284            
J013043F05          
J013049N05          
J013050H05          
J065053N22          
J065068A16          
J065103J04          
J065109I10          
J065137H06          
J065185N04          
J065218G08          
J065218J04          
J075020C11          
J075063E04          
J075064K03          
J075073L24          
J075108C10          
J080030F24          
TSS from cDNA
TSS information
009-015-H10                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-015-H10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+27460401-27

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGCCAGCCCAACC+2746011227460129-316-299
 OsREG493ATTTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG523       CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511        CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458         AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595          GCCCAACC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.