version
PlantPromoterDB promoter information of 009-034-G02

Summary of Gene (009-034-G02)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0565800        NCBI 
Gene model 009-034-G02  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 28430415-28431614)

Genome position     
from initiation codon
009-111-D12         
AK062431            
AK062820            
J065190K05          
J075022E05          
J075066F07          
J075146B21          
TSS from cDNA
TSS information
009-034-G02                      5'->3' (+)
Promoter sequence













 
AK067640            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-034-G02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+28431344-71
TSS clone peakAclone+28431353-62

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCTTGG+2843105428431061-361-354
 OsREG519GGGCTTGG PPDB MotifGCCCA  PLACE Motif 
REGCTGTCAGT+2843117428431181-241-234
 OsREG453CTGTCAGT PPDB Motif  PLACE MotifTGAC 
REGCGCACCGC+2843119428431201-221-214
 OsREG554CGCACCGC PPDB Motif  PLACE Motif 
REGAATTGGGCTGC+2843122228431232-193-183
 OsREG433AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG511  TTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG591   TGGGCTGC PPDB MotifGCCCA  PLACE Motif 
REGAATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCA+2843123628431274-179-141
 OsREG431AATGGGCC         GGCCCATT               PPDB MotifGCCCA  PLACE Motif 
 OsREG490 ATGGGCCG       CGGCCCAT                PPDB MotifGCCCA  PLACE Motif 
 OsREG618  TGGGCCGC                              PPDB MotifGCCCA  PLACE Motif 
 OsREG643   GGGCCGCA                             PPDB MotifGCCCA  PLACE Motif 
 OsREG554       CGCACCGC                         PPDB Motif  PLACE Motif 
 OsREG500         CACCGCAC                       PPDB Motif  PLACE Motif 
 OsREG504              CACGGCCC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG445               ACGGCCCA                 PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG660                       TTGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG578                        TGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620                         GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603                          GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533                           CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523                            CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491                             CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466                              AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607                               GCCCATCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.