version
PlantPromoterDB promoter information of 009-035-B01

Summary of Gene (009-035-B01)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0851200        NCBI 
Gene model 009-035-B01  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 36680166-36681365)

Genome position     
from initiation codon
009-134-F10         
009-154-H05         
AK059425            
J065065D24          
J075046G20          
J075046O19          
J075048O04          
J075181I09          
J080303G20          
J090086F12          
J090088E07          
TSS from cDNA
TSS information
009-035-B01                      5'->3' (+)
Promoter sequence









 
AF303468            
AK102069            
J023007E15          
J033082G06          
J043036M21          
J065158H05          
J065192A04          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-035-B01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone+36681096-70

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCT+3668105436681062-112-104
Y PatchCTCCCTCTC+3668112636681134-40-32
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCC+3668099136681049-175-117
 OsREG422AAATGGGC                                                    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC                                                   PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG                                                  PPDB MotifGCCCA  PLACE Motif 
 OsREG645    GGGCCGTACGGCCC                                          PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGTACGGCCCA                                         PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564            CGGCCCAC                                        PPDB MotifGCCCA  PLACE Motif 
 OsREG478             GGCCCACT          GGCCCACT          GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG475                     AGGGCCCA          AGGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG489                      GGGCCCAT          GGGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG630                       GGCCCATA          GGCCCATA           PPDB MotifGCCCA  PLACE Motif 
 OsREG656                             TAGGCCCA          TAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG472                              AGGCCCAC          AGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG532                                                   CCCACTCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-36680934AK102069, AK102069, J033082G06, AF303468, J043036M21, J065158H05, J065192A04

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCCTCCTCTC-3668089336680908AF303468, AK102069, J033082G06, J043036M21, J065158H05, J065192A04
Y PatchCCTCTCCTCCCC-3668093536680946AF303468, AK102069, J033082G06, J043036M21, J065158H05, J065192A04
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTT-3668099136681049AF303468, AK102069, J033082G06, J043036M21, J065158H05, J065192A04
 OsREG532GGAGTGGG                                                    PPDB MotifGCCCA  PLACE Motif 
 OsREG478  AGTGGGCC          AGTGGGCC          AGTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG472   GTGGGCCT          GTGGGCCT                               PPDB MotifGCCCA  PLACE Motif 
 OsREG656    TGGGCCTA          TGGGCCTA                              PPDB MotifGCCCA  PLACE Motif 
 OsREG630          TATGGGCC          TATGGGCC                        PPDB MotifGCCCA  PLACE Motif 
 OsREG489           ATGGGCCC          ATGGGCCC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG475            TGGGCCCT          TGGGCCCT                      PPDB MotifGCCCA  PLACE Motif 
 OsREG564                                       GTGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG645                                         GGGCCGTACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445                                        TGGGCCGTACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490                                                 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431                                                  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422                                                   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGGTTGGTGG-3668111736681124AF303468, AK102069, J033082G06, J043036M21, J065158H05, J065192A04
 OsREG520GTTGGTGG PPDB MotifCCAACGG  PLACE Motif 
REGCTCGCGCGC-3668114636681154AF303468, AK102069, J033082G06, J043036M21, J065158H05, J065192A04
 OsREG558CTCGCGCG  PPDB MotifACGCGC  PLACE Motif 
 OsREG617 TCGCGCGC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.