version
PlantPromoterDB promoter information of 009-074-B07

Summary of Gene (009-074-B07)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0287900        NCBI 
Gene model 009-074-B07  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 10005912-10004713)

Genome position     
from initiation codon
009-054-F05         
014-027-E07         
AK063663            
J065009N21          
TSS from cDNA
TSS information
009-074-B07                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-074-B07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-10005792-880

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCCCTCTCTC-1000578810005799-876-887
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCCGGCCCAAG-1000584210005854-930-942
 OsREG616GGCCCGGC      PPDB Motif  PLACE Motif 
 OsREG614 GCCCGGCC     PPDB Motif  PLACE Motif 
 OsREG538  CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542   CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563    CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581     GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGGCGGGCCCCACGT-1000586510005877-953-965
 OsREG619GCGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG567 CGGGCCCC     PPDB MotifACGGGC  PLACE Motif 
 OsREG641  GGGCCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG572    GCCCCACG  PPDB Motif  PLACE Motif 
 OsREG450     CCCCACGT PPDB MotifACGT  PLACE Motif 
REGTCCGGGCCAGCCCAACC-1000588110005897-969-985
 OsREG633TCCGGGCC          PPDB Motif  PLACE Motif 
 OsREG523      CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511       CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458        AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595         GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGCA-1000591610005923-1004-1011
 OsREG643GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGTCTGGGCCCAATA-1000592810005940-1016-1028
 OsREG629TCTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639   GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492    GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596     GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCTC-1000596110005971-1049-1059
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.