version
PlantPromoterDB promoter information of 009-075-B01

Summary of Gene (009-075-B01)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0397300        NCBI 
Gene model 009-075-B01  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 19339140-19337941)

Genome position     
from initiation codon
009-051-E02         
009-060-E03         
009-082-B11         
009-136-D05         
AK062621            
AK066003            
AK070832            
J023066C05          
TSS from cDNA
TSS information
009-075-B01                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-075-B01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-19338297-157

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTC-1933824819338255-108-115
Y PatchCCTCCTCCTCT-1933825919338269-119-129
Y PatchTCTCCCCC-1933830819338315-168-175
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGGCCCACGGCC-1933837319338385-233-245
 OsREG647GGGGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG    PPDB MotifGCCCA  PLACE Motif 
 OsREG547   GCCCACGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG521     CCACGGCC PPDB Motif  PLACE Motif 
REGTTCGTGGGGCCCACGA-1933841919338434-279-294
 OsREG529TTCGTGGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG572  CGTGGGGC       PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640      GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571       GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601        GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGTGGATGGG-1933849419338501-354-361
 OsREG534TGGATGGG PPDB MotifGCCCA  PLACE Motif 
REGCACGTCTC-1933852919338536-389-396
 OsREG506CACGTCTC PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.