version
PlantPromoterDB promoter information of 009-083-H02

Summary of Gene (009-083-H02)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0568900        NCBI 
Gene model 009-083-H02  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 23543192-23541993)

Genome position     
from initiation codon
AK062660            
TSS from cDNA
TSS information
009-083-H02                      5'->3' (-)
Promoter sequence









 
AK073915            
J033076M01          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-083-H02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-23542223-31

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAGCCCAGTT-2354226423542274-72-82
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG425   GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCTTATTGGGCTTA-2354227823542298-86-106
 OsREG610TAATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG596          TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG460           ATTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426            TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655             TGGGCTTA PPDB MotifGCCCA  PLACE Motif 
REGAACTGGGCCCATTTTGGGCTAAGCCCATCG-2354230723542336-115-144
 OsREG425AACTGGGC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG489    GGGCCCAT                   PPDB MotifGCCCA  PLACE Motif 
 OsREG431     GGCCCATT                  PPDB MotifGCCCA  PLACE Motif 
 OsREG422      GCCCATTT                 PPDB MotifGCCCA  PLACE Motif 
 OsREG592           TTTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG457            TTTGGGCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG655                   TAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429                    AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466                     AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG553                      GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCCCCCACG-2354234823542362-156-170
 OsREG605TTATGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG613      GCCCCCAC  PPDB Motif  PLACE Motif 
 OsREG536       CCCCCACG PPDB Motif  PLACE Motif 
REGGGCCGTGG-2354238823542395-196-203
 OsREG521GGCCGTGG PPDB Motif  PLACE Motif 
REGCGCGTGGG-2354250123542508-309-316
 OsREG530CGCGTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+23542408AK073915, AK073915

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAACTGGGCTGG+2354226423542274AK073915
 OsREG425AACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG512  CTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCAATAAGGCCCATTA+2354227823542298AK073915
 OsREG655TAAGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG460  AGCCCAAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG596   GCCCAATA           PPDB MotifGCCCA  PLACE Motif 
 OsREG430          AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474           AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431            GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610             GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGCGATGGGCTTAGCCCAAAATGGGCCCAGTT+2354230723542336AK073915
 OsREG553CGATGGGC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT                      PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT                     PPDB MotifGCCCA  PLACE Motif 
 OsREG655   TGGGCTTA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG457          AGCCCAAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG592           GCCCAAAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG422                AAATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG431                 AATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG489                  ATGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579                    GGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454                     GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG425                      GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGCGTGGGGGCCCATAA+2354234823542362AK073915
 OsREG536CGTGGGGG        PPDB Motif  PLACE Motif 
 OsREG613 GTGGGGGC       PPDB Motif  PLACE Motif 
 OsREG647    GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG489     GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630      GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605       GCCCATAA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.