version
PlantPromoterDB promoter information of 009-086-G10

Summary of Gene (009-086-G10)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0240700        NCBI 
Gene model 009-086-G10  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 7499771-7498572)

Genome position     
from initiation codon
AK071799            
J023112A13          
J043022A01          
J065106A01          
J075023P22          
J075138I21          
J075173L02          
TSS from cDNA
TSS information
009-086-G10                      5'->3' (-)
Promoter sequence












 
006-092-D05         
AK059292            
AK061178            
AK121552            
J023131D06          
J033033E14          
J033105B01          
J033114L18          
J033132N24          
J065032H03          
J065115J20          
J065150C05          
J080302A11          
J080302H16          
J080305M12          
J080306F13          
J080312A06          
J090088P09          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence












 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-086-G10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-7498906-135

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAATGGGCCCGGCCCAAAC-74989987499016-227-245
 OsREG610TAATGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG         PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543    GGGCCCGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG616     GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614      GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538       CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542        CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563         CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625          GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593           GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGAATGGGCCTAGCCCAACA-74990247499041-253-270
 OsREG431AATGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG474 ATGGGCCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA         PPDB MotifGCCCA  PLACE Motif 
 OsREG458         AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594          GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGGCCCAACA-74990497499062-278-291
 OsREG616GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614 GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538  CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563    CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626     GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594      GCCCAACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+7499147AK061178, J033105B01, J033114L18, AK061178, 006-092-D05, AK121552, J033033E14, J090088P09, J023131D06, J080302H16, J080305M12, AK059292, J080302A11, J080312A06, J033132N24, J080306F13, J065032H03, J065115J20, J065150C05

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCT+74991277499135006-092-D05, AK059292, AK061178, AK121552, J023131D06, J033033E14, J033105B01, J033114L18, J033132N24, J065032H03, J065115J20, J065150C05, J080302A11, J080302H16, J080305M12, J080306F13, J080312A06, J090088P09
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGACGCGT+74988917498898006-092-D05, AK059292, AK061178, AK121552, J023131D06, J033033E14, J033105B01, J033114L18, J033132N24, J065032H03, J065115J20, J065150C05, J080302A11, J080302H16, J080305M12, J080306F13, J080312A06, J090088P09
 OsREG442GGACGCGT PPDB Motif  PLACE Motif 
REGGACAGGTGGG+74989197498928006-092-D05, AK059292, AK061178, AK121552, J023131D06, J033033E14, J033105B01, J033114L18, J033132N24, J065032H03, J065115J20, J065150C05, J080302A11, J080302H16, J080305M12, J080306F13, J080312A06, J090088P09
 OsREG501GACAGGTG   PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG  PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCGGGCCCATTA+74989987499016006-092-D05, AK059292, AK061178, AK121552, J023131D06, J033033E14, J033105B01, J033114L18, J033132N24, J065032H03, J065115J20, J065150C05, J080302A11, J080302H16, J080305M12, J080306F13, J080312A06, J090088P09
 OsREG593GTTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG          PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC       PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543       CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566        CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG489         GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431          GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610           GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGCTAGGCCCATT+74990247499041006-092-D05, AK059292, AK061178, AK121552, J023131D06, J033033E14, J033105B01, J033114L18, J033132N24, J065032H03, J065115J20, J065150C05, J080302A11, J080302H16, J080305M12, J080306F13, J080312A06, J090088P09
 OsREG594TGTTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG458 GTTGGGCT          PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG656        TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG474         AGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG431          GGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGCCGGGCC+74990497499062006-092-D05, AK059292, AK061178, AK121552, J023131D06, J033033E14, J033105B01, J033114L18, J033132N24, J065032H03, J065115J20, J065150C05, J080302A11, J080302H16, J080305M12, J080306F13, J080312A06, J090088P09
 OsREG594TGTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC      PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC  PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.