version
PlantPromoterDB promoter information of 009-088-F09

Summary of Gene (009-088-F09)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0466600        NCBI 
Gene model 009-088-F09  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 22948016-22949215)

Genome position     
from initiation codon
009-105-C11         
009-156-C06         
AK119240            
TSS from cDNA
TSS information
009-088-F09                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-088-F09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+22948926-90

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCCTCCCCTTTCTTCCCC+2294889922948918-117-98
Y PatchTCTCTCTC+2294896722948974-49-42
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGATCCG+2294877222948779-244-237
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGCACGCCACGTC+2294878522948795-231-221
 OsREG502CACGCCAC    PPDB Motif  PLACE Motif 
 OsREG448  CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585   GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCCCGCG+2294881122948818-205-198
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCTCCCCCATCCAACGGC+2294884322948859-173-157
 OsREG574CTCCCCCA          PPDB Motif  PLACE Motif 
 OsREG534    CCCATCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG481       ATCCAACG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG548        TCCAACGG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG518         CCAACGGC PPDB MotifCCAACGG  PLACE Motif 
REGCCCACTCC+2294886922948876-147-140
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.