version
PlantPromoterDB promoter information of 009-101-D07

Summary of Gene (009-101-D07)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0657300        NCBI 
Gene model 009-101-D07  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 28154866-28156065)

Genome position     
from initiation codon
AK062752            
TSS from cDNA
TSS information
009-101-D07                      5'->3' (+)
Promoter sequence






 
006-108-F02         
AK059959            
J065031F13          
J090054M03          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-101-D07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+28155783-83

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACGGGCC+2815558528155592-281-274
 OsREG424AACGGGCC PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGAATGGGCCGAGA+2815560628155617-260-249
 OsREG431AATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG490 ATGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG575   GGGCCGAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG635    GGCCGAGA PPDB Motif  PLACE Motif 
REGGAGGCCCAAAC+2815564828155658-218-208
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGGCTGGGCCGTG+2815566528155675-201-191
 OsREG620GCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504   GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCTGT+2815568428155694-182-172
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG435   TGGGCTGT PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCATGA+2815571528155725-151-141
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG467  AGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609   GCCCATGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-28155495AK059959, AK059959

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTATAAATG-2815551828155526AK059959
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGCCCGTT-2815558528155592AK059959
 OsREG424GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGTCTCGGCCCATT-2815560628155617AK059959
 OsREG635TCTCGGCC     PPDB Motif  PLACE Motif 
 OsREG575 CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG490   CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG431    GGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCTC-2815564828155658AK059959
 OsREG593GTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCAGC-2815566528155675AK059959
 OsREG504CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCATTT-2815568428155694AK059959
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCTTT-2815571528155725AK059959
 OsREG609TCATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGGTTGGTGG-2815578128155788AK059959
 OsREG520GTTGGTGG PPDB MotifCCAACGG  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.