version
PlantPromoterDB promoter information of 009-102-F03

Summary of Gene (009-102-F03)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0547850        NCBI 
Gene model 009-102-F03  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 27264918-27263719)

Genome position     
from initiation codon
013-076-H08         
AK058330            
AK122158            
AY626826            
J033147B11          
J043012O19          
J043038O15          
J053094L06          
TSS from cDNA
TSS information
009-102-F03                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-102-F03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-27264016-98
TSS clone peakAclone-27264012-94

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCTCTTCCTCTC-2726399127264008-73-90
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCAGAT-2726405727264067-139-149
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486   GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCTTGGGCCGAAA-2726407327264092-155-174
 OsREG456AGATGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT          PPDB MotifGCCCA  PLACE Motif 
 OsREG497    GGGCCTTG         PPDB MotifGCCCA  PLACE Motif 
 OsREG581        CTTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG563         TTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658          TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG642           GGGCCGAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG634            GGCCGAAA PPDB Motif  PLACE Motif 
REGCGGATCGGACGGCC-2726409427264107-176-189
 OsREG541CGGATCGG       PPDB Motif  PLACE Motif 
 OsREG589  GATCGGAC     PPDB Motif  PLACE Motif 
 OsREG484   ATCGGACG    PPDB Motif  PLACE Motif 
 OsREG545    TCGGACGG   PPDB Motif  PLACE Motif 
 OsREG562     CGGACGGC  PPDB Motif  PLACE Motif 
 OsREG624      GGACGGCC PPDB Motif  PLACE Motif 
REGGATCGGACG-2726412627264134-208-216
 OsREG589GATCGGAC  PPDB Motif  PLACE Motif 
 OsREG484 ATCGGACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.