version
PlantPromoterDB promoter information of 009-103-F06

Summary of Gene (009-103-F06)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0832200        NCBI 
Gene model 009-103-F06  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 37369808-37368609)

Genome position     
from initiation codon
004-009-E08         
AK060017            
AK068980            
J023002I10          
J023085I24          
J090016I03          
J090078K06          
J100032H12          
J100035A07          
TSS from cDNA
TSS information
009-103-F06                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-103-F06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-37368941-83
TSS clone peakAclone-37368940-82

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTTCC-3736895137368958-93-100
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCAGCCCA-3736903937369046-181-188
 OsREG657TCAGCCCA PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGCCCATCA-3736905137369063-193-205
 OsREG628GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489   GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590    GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607     GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGTCCGTCCG-3736908137369088-223-230
 OsREG561TCCGTCCG PPDB Motif  PLACE Motif 
REGATTTGGGCTGG-3736909737369107-239-249
 OsREG493ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG511  TTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.