version
PlantPromoterDB promoter information of 009-105-D10

Summary of Gene (009-105-D10)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0617800        NCBI 
Gene model 009-105-D10  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 25882739-25883938)

Genome position     
from initiation codon
                    
AK062778            
Os11g0617750        
TSS from cDNA
TSS information
009-105-D10                      5'->3' (+)
Promoter sequence









 
                    
Os11g0617900        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-105-D10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone+25883552-187

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGGCCCATTCTGGCCCAACA+2588330425883325-435-414
 OsREG504CACGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA              PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT            PPDB MotifGCCCA  PLACE Motif 
 OsREG638          TCTGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG577           CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659            TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626             GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594              GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGATTGGGCTTA+2588333425883343-405-396
 OsREG460ATTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426 TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655  TGGGCTTA PPDB MotifGCCCA  PLACE Motif 
REGTGTCAGTG+2588346225883469-277-270
 OsREG510TGTCAGTG PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.