version
PlantPromoterDB promoter information of 009-106-E01

Summary of Gene (009-106-E01)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0465800        NCBI 
Gene model 009-106-E01  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 18316872-18315673)

Genome position     
from initiation codon
AK062785            
J065122K21          
J100069H20          
TSS from cDNA
TSS information
009-106-E01                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-106-E01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-18315938-66

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCTCTCTCC-1831589218315903-20-31
Y PatchCTCCTCCC-1831591718315924-45-52
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGCCCAGCCCAAAA-1831600818316024-136-152
 OsREG615GCCGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533     CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523      CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511       CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457        AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592         GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGCTCTCCGC-1831607618316083-204-211
 OsREG576CTCTCCGC PPDB Motif  PLACE Motif 
REGAAAGCCCAAAA-1831608818316098-216-226
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGCACACACC-1831614218316149-270-277
 OsREG499CACACACC PPDB Motif  PLACE Motif 
REGAAAAGCCCAC-1831616618316175-294-303
 OsREG419AAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG427  AAGCCCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.