version
PlantPromoterDB promoter information of 009-111-H03

Summary of Gene (009-111-H03)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0401300        NCBI 
Gene model 009-111-H03  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 19520213-19521412)

Genome position     
from initiation codon
AK060678            
TSS from cDNA
TSS information
009-111-H03                      5'->3' (+)
Promoter sequence











 
009-070-A03         
J013039I06          
J013050L10          
J013121G02          
J013151B07          
J013159P07          
J013170J11          
J023065G03          
J023069D06          
J023075F20          
J043040P14          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-111-H03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+19521115-98

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTC+1952112619521133-87-80
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGACCCG+1952082719520834-386-379
 OsREG569GGGACCCG PPDB MotifGGGACCC  PLACE Motif 
REGGTCCCTCA+1952086019520867-353-346
 OsREG652GTCCCTCA PPDB MotifGGGACCC  PLACE Motif 
REGGATCGGAC+1952095719520964-256-249
 OsREG589GATCGGAC PPDB Motif  PLACE Motif 
REGGTGGGCTTT+1952099719521005-216-208
 OsREG427GTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421 TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGCCGTGGGCCGTGGGCCGTG+1952103319521051-180-162
 OsREG547CCGTGGGCCGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCCGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCGTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGTGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTGGGCCGTG PPDB MotifGCCCA  PLACE Motif 
 OsREG521     GGCCGTGG       PPDB Motif  PLACE Motif 
REGAGGGCCCACCA+1952106419521074-149-139
 OsREG475AGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.