version
PlantPromoterDB promoter information of 009-112-E09

Summary of Gene (009-112-E09)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0115200        NCBI 
Gene model 009-112-E09  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 839002-837803)

Genome position     
from initiation codon
AK071287            
J023007E23          
J023088J06          
J065075D17          
J065108G15          
J065142O04          
J065165A16          
J075015O12          
J075022O06          
J075031H14          
J075033D10          
J075070A04          
J075098E01          
J075105D08          
J075127A05          
J075146P22          
J075176F22          
J075178C07          
J075188F07          
J100041N23          
J100055M13          
J100070B16          
Os03g0115300        
TSS from cDNA
TSS information
009-112-E09                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-112-E09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-838104-102

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAAACC-838128838135-126-133
Y PatchCCTCCTCTCTTCCCC-838096838110-94-108
Y PatchCCTTCTCC-838113838120-111-118
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCGGCCCAATA-838145838157-143-155
 OsREG634TTTCGGCC      PPDB Motif  PLACE Motif 
 OsREG642 TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563   CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492    GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596     GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGTCGGACGGCCCATG-838167838180-165-178
 OsREG545TCGGACGG       PPDB Motif  PLACE Motif 
 OsREG562 CGGACGGC      PPDB Motif  PLACE Motif 
 OsREG624  GGACGGCC     PPDB Motif  PLACE Motif 
 OsREG584   GACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445    ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490     CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG517      GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGAGCCCATTA-838197838205-195-203
 OsREG432AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610 GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCATTA-838229838239-227-237
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.