version
PlantPromoterDB promoter information of 009-115-G01

Summary of Gene (009-115-G01)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0186000        NCBI 
Gene model 009-115-G01  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 5260774-5259575)

Genome position     
from initiation codon
006-103-D10         
009-047-D06         
009-073-G05         
009-084-G09         
009-097-G04         
009-111-D11         
009-131-B04         
009-144-F05         
009-154-D08         
014-004-H02         
AK058675            
AK060420            
AK061231            
J065011J02          
J065155C08          
J075143K12          
TSS from cDNA
TSS information
009-115-G01                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-115-G01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-5259816-42
TSS clone peakAclone-5259815-41
TSS cloneAclone-5259806-32

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTCTC-52597815259790-7-16
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCAATCCATGGGCCTGGGCTTC-52598625259888-88-114
 OsREG421AAAGCCCA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG460  AGCCCAAT                  PPDB MotifGCCCA  PLACE Motif 
 OsREG525          CCATGGGC          PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517           CATGGGCC         PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474            ATGGGCCT        PPDB MotifGCCCA  PLACE Motif 
 OsREG513             TGGGCCTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG524              GGGCCTGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG428                  CTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG582                   TGGGCTTC PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCAAG-52598935259902-119-128
 OsREG656TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCTTGG-52599075259918-133-144
 OsREG609TCATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG429  ATGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG519    GGGCTTGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.