version
PlantPromoterDB promoter information of 009-122-E09

Summary of Gene (009-122-E09)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0390600        NCBI 
Gene model 009-122-E09  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 16195566-16196765)

Genome position     
from initiation codon
009-044-A03         
009-129-F04         
009-132-E03         
009-142-G08         
009-154-B03         
009-170-F01         
009-191-E08         
009-197-D07         
AF467728            
AK063199            
AK104901            
AK120198            
D29713              
J013036N20          
J023038I23          
J023060E17          
J065001D19          
J065035E03          
J065041L04          
J065045K01          
J065056G09          
J065061L10          
J065068F02          
J065074E07          
J065076C08          
J065078E21          
J065083N14          
J065103P19          
J065110H24          
J065113D24          
J065119A08          
J065123B16          
J065128K06          
J065130F24          
J065141H22          
J065142K19          
J065165K04          
J065168M08          
J065204G20          
J065207L15          
J065208N23          
J065212O13          
J075023O19          
J075058D21          
J075071P19          
J075098D21          
J075192A22          
J075197D08          
J080003G09          
J080040D03          
J090022H08          
J090053F16          
J090091B05          
J100049C14          
J100072K11          
TSS from cDNA
TSS information
009-122-E09                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-122-E09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+16196565-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCGCTATAAATA+1619653116196542-35-24
Y PatchTCTTCCTCCTCCTC+16196589161966022336
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGACC+1619632916196336-237-230
 OsREG650GTGGGACC PPDB MotifGGGACCC  PLACE Motif 
REGCCGATCCG+1619633816196345-228-221
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGGCCGTCCGATC+1619643416196444-132-122
 OsREG562GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545 CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484  CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589   GTCCGATC PPDB Motif  PLACE Motif 
REGATCTCGGCCGTCCGA+1619647216196486-94-80
 OsREG485ATCTCGGC        PPDB Motif  PLACE Motif 
 OsREG635 TCTCGGCC       PPDB Motif  PLACE Motif 
 OsREG624     GGCCGTCC   PPDB Motif  PLACE Motif 
 OsREG562      GCCGTCCG  PPDB Motif  PLACE Motif 
 OsREG545       CCGTCCGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.