version
PlantPromoterDB promoter information of 009-124-G10

Summary of Gene (009-124-G10)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0966200        NCBI 
Gene model 009-124-G10  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 44410442-44409243)

Genome position     
from initiation codon
009-079-H11         
AK058564            
AK098935            
TSS from cDNA
TSS information
009-124-G10                      5'->3' (-)
Promoter sequence






 
003-112-B12         
AK073175            
J033023J10          
J075023O04          
J075047L15          
J075054H12          
J075056H14          
J075057L15          
J075066F23          
J075087C08          
J075091H05          
J075152G20          
J090048C07          
J090075C18          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-124-G10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-44409468-26
TSS clone peakCclone-44409459-17

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCCTCCTC-4440944944409460-7-18
Y PatchCCTCCCCC-4440951144409518-69-76
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCCCCCA-4440951044409517-68-75
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 
REGACGTGGCG-4440953744409544-95-102
 OsREG448ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGAGGCCCAGTA-4440955444409564-112-122
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454  GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG604   GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGGTGGGCTTA-4440957944409587-137-145
 OsREG427GTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655 TGGGCTTA PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGCCGTA-4440962144409632-179-190
 OsREG594TGTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG645    GGGCCGTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.