version
PlantPromoterDB promoter information of 009-125-E08

Summary of Gene (009-125-E08)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0555300        NCBI 
Gene model 009-125-E08  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 27690098-27688899)

Genome position     
from initiation codon
009-032-C03         
009-149-C12         
009-172-C01         
AK062890            
AK062997            
TSS from cDNA
TSS information
009-125-E08                      5'->3' (-)
Promoter sequence





 
                    
Os05g0555350        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-125-E08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-27689130-32

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGTGGCGCGCGAG-2768918927689203-91-105
 OsREG573CGTGTGGC        PPDB Motif  PLACE Motif 
 OsREG617      GCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG558       CGCGCGAG PPDB MotifACGCGC  PLACE Motif 
REGGTTTGGGCCCT-2768925127689261-153-163
 OsREG593GTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475   TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGTGCGGCCC-2768927327689280-175-182
 OsREG643TGCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGCGTGCGCTGGCCCACGG-2768928727689305-189-207
 OsREG555CGCGTGCG            PPDB Motif  PLACE Motif 
 OsREG577        CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG654         TGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571          GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG547           GCCCACGG PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCAACA-2768931727689327-219-229
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626  GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-2768936727689374-269-276
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.