version
PlantPromoterDB promoter information of 009-127-G03

Summary of Gene (009-127-G03)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0626100        NCBI 
Gene model 009-127-G03  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 26592475-26591276)

Genome position     
from initiation codon
AK062899            
TSS from cDNA
TSS information
009-127-G03                      5'->3' (-)
Promoter sequence







 
AK069686            
J065115C16          
J065172A02          
J065172E23          
J075120P10          
J090031L15          
J090071F02          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-127-G03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-26591478-3

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATGGGCCAA-2659152026591529-45-54
 OsREG431AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488 ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660  TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGAACGGGCCAGA-2659160526591615-130-140
 OsREG424AACGGGCC    PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG638   GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGACAGGTGGGCCAC-2659169226591705-217-230
 OsREG501GACAGGTG       PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG      PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG476   AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654     GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653      TGGGCCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.