version
PlantPromoterDB promoter information of 009-129-D11

Summary of Gene (009-129-D11)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0445500        NCBI 
Gene model 009-129-D11  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 21882843-21884042)

Genome position     
from initiation codon
009-021-C05         
009-147-E04         
009-169-C11         
AK058730            
AK121459            
J023001K23          
J023107J19          
J023143J09          
J065049D04          
J065092I06          
J065188H04          
TSS from cDNA
TSS information
009-129-D11                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-129-D11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+21881246-847

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCGCTATATATG+2188120221881213-891-880
Y PatchTCCTCCCCT+2188125821881266-835-827
Y PatchTCTTCCCC+2188128421881291-809-802
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGTGGGCT+2188095321880961-1140-1132
 OsREG597TTGTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG461 TGTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCT+2188096721880975-1126-1118
 OsREG609TCATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTCTGGCCCATT+2188098221880992-1111-1101
 OsREG638TCTGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG577 CTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG488  TGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGGCAGCCCATG+2188101221881021-1081-1072
 OsREG591GCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG467  AGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTCCGGCCCATGGGCCGTGGGCCTC+2188109321881116-1000-977
 OsREG644TCCGGCCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG525    GCCCATGGGC           PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517   GGCCCATGGGCC          PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  CGGCCCATGGGCCG         PPDB MotifGCCCA  PLACE Motif 
 OsREG445         TGGGCCGT        PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504          GGGCCGTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG521           GGCCGTGG      PPDB Motif  PLACE Motif 
 OsREG547             CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571              CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472               GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587                TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGATCCAACGG+2188114621881154-947-939
 OsREG481ATCCAACG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG PPDB MotifCCAACGG  PLACE Motif 
REGCGTTCCGT+2188119321881200-900-893
 OsREG444CGTTCCGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.