PlantPromoterDB promoter information of 009-132-E07

Summary of Gene (009-132-E07)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0816700        NCBI 
Gene model 009-132-E07  
Description NONE  


Focused view (chromosome 2: 35901169-35899970)

Genome position     
from initiation codon
TSS from cDNA
TSS information
009-132-E07                      5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


Promoter Summary of 009-132-E07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakGclone-35900246-77

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTC-3590022835900235-59-66

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 OsREG610TAATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG            PPDB MotifGCCCA  PLACE Motif 
 OsREG645    GGGCCGTA          PPDB MotifGCCCA  PLACE Motif 
 OsREG656          TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474           AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG422             GCCCATTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakAclone+35900439AK102271, J023049N06, J023069G18, J090041F23, J090092H16, J023002E08, J033103L07, J013124I08, J023037O12, J033037L22, J023025C01, AK102271, J033089A08, J033029M02, J013105O04, 013-089-A09, J090008N20, J033125L19

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCTC+3590044535900452013-089-A09, AK102271, J013105O04, J013124I08, J023002E08, J023025C01, J023037O12, J023049N06, J023069G18, J033029M02, J033037L22, J033089A08, J033103L07, J033125L19, J090008N20, J090041F23, J090092H16
Y PatchCCTTCCTCC+3590046135900469013-089-A09, AK102271, J013105O04, J013124I08, J023002E08, J023025C01, J023037O12, J023049N06, J023069G18, J033029M02, J033037L22, J033089A08, J033103L07, J033125L19, J090008N20, J090041F23, J090092H16

REG information

TypeSequenceAnnotationGenome positionGene model
REGTCCACGCC+3590014835900155013-089-A09, AK102271, J013105O04, J013124I08, J023002E08, J023025C01, J023037O12, J023049N06, J023069G18, J033029M02, J033037L22, J033089A08, J033103L07, J033125L19, J090008N20, J090041F23, J090092H16
REGGGACGCGTCCACCAAC+3590024335900258013-089-A09, AK102271, J013105O04, J013124I08, J023002E08, J023025C01, J023037O12, J023049N06, J023069G18, J033029M02, J033037L22, J033089A08, J033103L07, J033125L19, J090008N20, J090041F23, J090092H16
 OsREG442GGACGCGTCC       PPDB Motif  PLACE Motif 
REGAAATGGGCCTACGGCCCATTA+3590029035900310013-089-A09, AK102271, J013105O04, J013124I08, J023002E08, J023025C01, J023037O12, J023049N06, J023069G18, J033029M02, J033037L22, J033089A08, J033103L07, J033125L19, J090008N20, J090041F23, J090092H16
 OsREG422AAATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA           PPDB MotifGCCCA  PLACE Motif 
 OsREG645         TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG490           CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG610             GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATAA+3590031435900322013-089-A09, AK102271, J013105O04, J013124I08, J023002E08, J023025C01, J023037O12, J023049N06, J023069G18, J033029M02, J033037L22, J033089A08, J033103L07, J033125L19, J090008N20, J090041F23, J090092H16
REGTAGGCCCATTA+3590032735900337013-089-A09, AK102271, J013105O04, J013124I08, J023002E08, J023025C01, J023037O12, J023049N06, J023069G18, J033029M02, J033037L22, J033089A08, J033103L07, J033125L19, J090008N20, J090041F23, J090092H16
REGAGCCCATAA+3590034135900349013-089-A09, AK102271, J013105O04, J013124I08, J023002E08, J023025C01, J023037O12, J023049N06, J023069G18, J033029M02, J033037L22, J033089A08, J033103L07, J033125L19, J090008N20, J090041F23, J090092H16
REGAATTGGGCCCAACT+3590035235900365013-089-A09, AK102271, J013105O04, J013124I08, J023002E08, J023025C01, J023037O12, J023049N06, J023069G18, J033029M02, J033037L22, J033089A08, J033103L07, J033125L19, J090008N20, J090041F23, J090092H16
REGAATTGGGCCTC+3590037735900387013-089-A09, AK102271, J013105O04, J013124I08, J023002E08, J023025C01, J023037O12, J023049N06, J023069G18, J033029M02, J033037L22, J033089A08, J033103L07, J033125L19, J090008N20, J090041F23, J090092H16

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.