version
PlantPromoterDB promoter information of 009-142-E09

Summary of Gene (009-142-E09)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0154900        NCBI 
Gene model 009-142-E09  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 2974568-2975767)

Genome position     
from initiation codon
AK062969            
TSS from cDNA
TSS information
009-142-E09                      5'->3' (+)
Promoter sequence

















 
AK111389            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-142-E09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2975491-77

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCTCT+29754422975453-126-115
Y PatchTCCCCTCTCTT+29754632975473-105-95
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGTGGC+29752512975258-317-310
 OsREG585GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCACGTGGC+29752922975299-276-269
 OsREG507CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGACGTGGC+29753032975310-265-258
 OsREG585GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTGGGACCCAC+29753502975360-218-208
 OsREG650GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637  GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622   GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGGGGCCCACGTGGGCCCCACGTGTC+29753982975422-170-146
 OsREG647GGGGCCCA  TGGGCCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCACGTGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG508    CCCACGTGGG CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG449   GCCCACGTGGGC           PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571  GGCCCACGTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG641           GGGCCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG631            GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG572             GCCCCACG     PPDB Motif  PLACE Motif 
 OsREG450              CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG434                CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509                 CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.