version
PlantPromoterDB promoter information of 009-154-G01

Summary of Gene (009-154-G01)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0767900        NCBI 
Gene model 009-154-G01  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 33235003-33236202)

Genome position     
from initiation codon
009-172-H09         
AK099885            
TSS from cDNA
TSS information
009-154-G01                      5'->3' (+)
Promoter sequence









 
                    
Os02g0767866        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-154-G01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+33235953-50

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGATGGGGGAG+3323570133235712-302-291
 OsREG534TGGATGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG574    TGGGGGAG PPDB Motif  PLACE Motif 
REGTTTTGGGCCCATAT+3323575633235769-247-234
 OsREG592TTTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489    GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630     GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480      GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGAGGTGGGCCTAGCCCATCG+3323577833235796-225-207
 OsREG476AGGTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA         PPDB MotifGCCCA  PLACE Motif 
 OsREG466          AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG553           GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCCCATAA+3323581833235831-185-172
 OsREG592TTTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489    GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630     GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605      GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGAGGTGGGCCTGGCCCATCA+3323584033235858-163-145
 OsREG476AGGTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG         PPDB MotifGCCCA  PLACE Motif 
 OsREG524    GGGCCTGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG577        CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488         TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590          GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607           GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGTTGGGCCTGG+3323587933235889-124-114
 OsREG626GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG471 TTGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG513  TGGGCCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG524   GGGCCTGG PPDB MotifGCCCA  PLACE Motif 
REGTGCGGCCCAGCCC+3323589633235908-107-95
 OsREG643TGCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG    PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC   PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GCCCAGCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG533     CCCAGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.