version
PlantPromoterDB promoter information of 009-155-B05

Summary of Gene (009-155-B05)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0507600        NCBI 
Gene model 009-155-B05  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 19636990-19638189)

Genome position     
from initiation codon
AK070613            
J023063G03          
TSS from cDNA
TSS information
009-155-B05                      5'->3' (+)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-155-B05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+19637954-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGGCCCACGT+1963773419637745-256-245
 OsREG641TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647 GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449    GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGTCCGGCCCACTTGTCGGCCCATGA+1963776119637784-229-206
 OsREG644TCCGGCCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC               PPDB MotifGCCCA  PLACE Motif 
 OsREG478   GGCCCACT              PPDB MotifGCCCA  PLACE Motif 
 OsREG498     CCCACTTG            PPDB MotifGCCCA  PLACE Motif 
 OsREG658             TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490              CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517               GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609                GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGAGTGGGCCTA+1963782119637830-169-160
 OsREG478AGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472 GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGGGGTGGGCCCATCTCGGCCCATGA+1963784519637868-145-122
 OsREG600GGGTGGGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG489    GGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG590     GGCCCATC            PPDB MotifGCCCA  PLACE Motif 
 OsREG456      GCCCATCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG485          ATCTCGGC       PPDB Motif  PLACE Motif 
 OsREG635           TCTCGGCC      PPDB Motif  PLACE Motif 
 OsREG575            CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658             TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490              CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517               GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609                GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGACGTCACC+1963787719637884-113-106
 OsREG447ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.