version
PlantPromoterDB promoter information of 009-171-H01

Summary of Gene (009-171-H01)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0581300        NCBI 
Gene model 009-171-H01  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 29754482-29753283)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
009-171-H01                      5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-171-H01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-29752699-67

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCC-2975271629752723-84-91
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATGGCCCACGCCACAAGCCCACAA-2975276729752790-135-158
 OsREG487ATGGCCCA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC                PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG               PPDB MotifGCCCA  PLACE Motif 
 OsREG602   GCCCACGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG502      CACGCCAC           PPDB Motif  PLACE Motif 
 OsREG496             CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG427              AAGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG461               AGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597                GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCCTTTTTGGGCCTA-2975279629752816-164-184
 OsREG493ATTTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC  TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG592          TTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG656             TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCATAAGGCCCAACA-2975282529752844-193-212
 OsREG487ATGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA           PPDB MotifGCCCA  PLACE Motif 
 OsREG605   GCCCATAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG430         AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471          AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626           GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594            GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCTC-2975285929752869-227-237
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGGACTCGAC-2975292829752935-296-303
 OsREG586GACTCGAC PPDB Motif  PLACE Motif 
REGGCCCATAA-2975294729752954-315-322
 OsREG605GCCCATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.