version
PlantPromoterDB promoter information of 009-191-B02

Summary of Gene (009-191-B02)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0611300        NCBI 
Gene model 009-191-B02  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 31396303-31397502)

Genome position     
from initiation codon
Os04g0611200        
TSS from cDNA
TSS information
009-191-B02                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-191-B02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+31398669-84

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCCTCTT+3139866231398673-91-80
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCT+3139839731398405-356-348
 OsREG592TTTTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCATCCA+3139849831398509-255-244
 OsREG660TTGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT    PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC   PPDB MotifGCCCA  PLACE Motif 
 OsREG608   GCCCATCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG534    CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCGAGAT+3139851331398526-240-227
 OsREG456AGATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA    PPDB MotifGCCCA  PLACE Motif 
 OsREG575    GGGCCGAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG635     GGCCGAGA  PPDB Motif  PLACE Motif 
 OsREG485      GCCGAGAT PPDB Motif  PLACE Motif 
REGTAGGCCCATCA+3139852831398538-225-215
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCTGGCCCAATT+3139856531398582-188-171
 OsREG596TATTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG511  TTGGGCTG         PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG577       CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659        TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492         GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433          GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGGCCCGGCCCAAG+3139860231398613-151-140
 OsREG614GCCCGGCC     PPDB Motif  PLACE Motif 
 OsREG538 CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542  CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563   CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581    GGCCCAAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.