version
PlantPromoterDB promoter information of 009-200-E07

Summary of Gene (009-200-E07)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0541900        NCBI 
Gene model 009-200-E07  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 26966684-26965485)

Genome position     
from initiation codon
009-130-F05         
009-195-H05         
013-057-G09         
AK066599            
J013069H24          
J023002F21          
J053036K02          
J080040C06          
J080064A04          
TSS from cDNA
TSS information
009-200-E07                      5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 009-200-E07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-26966250-566

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGCGTATAAAAG-2696627826966288-594-604
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACATGGGCCAA-2696635726966367-673-683
 OsREG437ACATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGTCAGCCCATT-2696637526966384-691-700
 OsREG657TCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGAACTGGGCTGGGCCTCCGTGGGCCGC-2696641726966442-733-758
 OsREG425AACTGGGC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG512  CTGGGCTG                 PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG                PPDB MotifGCCCA  PLACE Motif 
 OsREG533    GGGCTGGG               PPDB MotifGCCCA  PLACE Motif 
 OsREG603     GGCTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG620      GCTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG473       CTGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG587        TGGGCCTC           PPDB MotifGCCCA  PLACE Motif 
 OsREG547               CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571                CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG564                 GTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618                  TGGGCCGC PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCT-2696645426966461-770-777
 OsREG459CTTGGGCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.