version
PlantPromoterDB promoter information of 011-025-C09

Summary of Gene (011-025-C09)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0551400        NCBI 
Gene model 011-025-C09  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 21779567-21778368)

Genome position     
from initiation codon
009-003-D11         
AK066548            
D13758              
J013069H14          
J053037J07          
J065011J03          
J065078L15          
J065103H24          
J065157A07          
J065213P12          
J090007P04          
J090052N23          
TSS from cDNA
TSS information
011-025-C09                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 011-025-C09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-21778656-89

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCC-2177863121778638-64-71
Y PatchTCCCCCTC-2177864021778647-73-80
Y PatchTCCCCCTCTCCTCC-2177866321778676-96-109
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGCCAC-2177871321778720-146-153
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGATCCCCCA-2177873921778746-172-179
 OsREG482ATCCCCCA PPDB Motif  PLACE Motif 
REGCCCACCCGGCCCGGCCCACA-2177876421778783-197-216
 OsREG528CCCACCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG538    CCCGGCCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG544      CGGCCCGG       PPDB Motif  PLACE Motif 
 OsREG616       GGCCCGGC      PPDB Motif  PLACE Motif 
 OsREG614        GCCCGGCC     PPDB Motif  PLACE Motif 
 OsREG542          CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG564           CGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627            GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGACAGGTGGGACC-2177892021778931-353-364
 OsREG436ACAGGTGG     PPDB Motif  PLACE Motif 
 OsREG514 CAGGTGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG651   GGTGGGAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650    GTGGGACC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.