PlantPromoterDB promoter information of 011-038-H07

Summary of Gene (011-038-H07)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0169300        NCBI 
Gene model 011-038-H07  
Description NONE  


Focused view (chromosome 2: 3726962-3728161)

Genome position     
from initiation codon
TSS from cDNA
TSS information
011-038-H07                      5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


Promoter Summary of 011-038-H07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakAclone+3727548AK070041, 015-057-G02, 015-049-F11, 006-023-D12, J075013D12, 015-092-F04, J023077F10, J013134H23, J013134J23, AK070041, J023036N24, J023077E10, J023105N12, J013042K07, J023049C06, J033036O12, J033064P11, 006-062-B01, J033143E10, 015-097-B07, J033123M22, 015-095-H02, J033079F01

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATAAA+37275123727519006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
Y PatchCCCCCCTC+37275013727508006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
Y PatchCCTCCCTCCTCC+37275253727536006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
Y PatchTCTTCCTCTC+37275753727584006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12

REG information

TypeSequenceAnnotationGenome positionGene model
REGGCCCACCT+37272663727273006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
REGGCCCCCAC+37272913727298006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
REGCCGTGGGCCCACCAC+37273563727370006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
REGCCCACCTG+37274203727427006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
REGATCTGGGCCCCACGCCTCCCGGCCCCACA+37274443727472006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
 OsREG486ATCTGGGC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG629 TCTGGGCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC                    PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA                  PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC       GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG572      GCCCCACG                PPDB Motif  PLACE Motif 
 OsREG503          CACGCCTC            PPDB Motif  PLACE Motif 
 OsREG538                 CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG611                     GCCCCACA PPDB Motif  PLACE Motif 
REGGCGACGCG+37274783727485006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.