version
PlantPromoterDB promoter information of 011-038-H07

Summary of Gene (011-038-H07)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0169300        NCBI 
Gene model 011-038-H07  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 3727162-3728361)

Genome position     
from initiation codon
006-023-D12         
006-062-B01         
013-075-C09         
015-049-F11         
015-057-G02         
015-092-F04         
015-095-H02         
015-097-B07         
016-040-D02         
AK070041            
J013042K07          
J013134H23          
J013134J23          
J023036N24          
J023045D11          
J023049C06          
J023077E10          
J023077F10          
J023105N12          
J033036O12          
J033064P11          
J033079F01          
J033123M22          
J033143E10          
J075013D12          
J090014D20          
TSS from cDNA
TSS information
011-038-H07                      5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 011-038-H07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+3727548AK070041, 015-057-G02, 015-049-F11, 006-023-D12, J075013D12, 015-092-F04, J023077F10, J013134H23, J013134J23, AK070041, J023036N24, J023077E10, J023105N12, J013042K07, J023049C06, J033036O12, J033064P11, 006-062-B01, J033143E10, 015-097-B07, J033123M22, 015-095-H02, J033079F01

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATAAA+37275123727519006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
Y PatchCCCCCCTC+37275013727508006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
Y PatchCCTCCCTCCTCC+37275253727536006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
Y PatchTCTTCCTCTC+37275753727584006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCCCACCT+37272663727273006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
 OsREG476GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGGCCCCCAC+37272913727298006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
 OsREG613GCCCCCAC PPDB Motif  PLACE Motif 
REGCCGTGGGCCCACCAC+37273563727370006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
 OsREG547CCGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599      GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527       CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCCCACCTG+37274203727427006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
 OsREG514CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGATCTGGGCCCCACGCCTCCCGGCCCCACA+37274443727472006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
 OsREG486ATCTGGGC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG629 TCTGGGCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC                    PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA                  PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC       GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG572      GCCCCACG                PPDB Motif  PLACE Motif 
 OsREG503          CACGCCTC            PPDB Motif  PLACE Motif 
 OsREG538                 CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG611                     GCCCCACA PPDB Motif  PLACE Motif 
REGGCGACGCG+37274783727485006-023-D12, 006-062-B01, 015-049-F11, 015-057-G02, 015-092-F04, 015-095-H02, 015-097-B07, AK070041, J013042K07, J013134H23, J013134J23, J023036N24, J023049C06, J023077E10, J023077F10, J023105N12, J033036O12, J033064P11, J033079F01, J033123M22, J033143E10, J075013D12
 OsREG559GCGACGCG PPDB Motif  PLACE MotifCGACG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.