version
PlantPromoterDB promoter information of 011-041-G03

Summary of Gene (011-041-G03)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0325700        NCBI 
Gene model 011-041-G03  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 10132262-10133461)

Genome position     
from initiation codon
AK063334            
J080317M24          
TSS from cDNA
TSS information
011-041-G03                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 011-041-G03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+10133182-80

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTTATA+1013314310133150-119-112
Y PatchCCTCTCTC+1013317410133181-88-81
Y PatchTCTCTCTCTC+1013318410133193-78-69
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGTGGCG+1013291610132923-346-339
 OsREG448ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTTGGTGG+1013296510132972-297-290
 OsREG520GTTGGTGG PPDB MotifCCAACGG  PLACE Motif 
REGCACGTGTCCGGGCCTGG+1013298210132998-280-264
 OsREG509CACGTGTC          PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451 ACGTGTCC         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG633      TCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG524         GGGCCTGG PPDB MotifGCCCA  PLACE Motif 
REGGGACACGTGTCG+1013303010133041-232-221
 OsREG451GGACACGT     PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG452    ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCGGTGCG+1013304610133053-216-209
 OsREG554GCGGTGCG PPDB Motif  PLACE Motif 
REGGGACGGCCCGGA+1013307510133086-187-176
 OsREG624GGACGGCC     PPDB Motif  PLACE Motif 
 OsREG584 GACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG446  ACGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544   CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG633    GGCCCGGA PPDB Motif  PLACE Motif 
REGCCCACCACCTGTC+1013309710133109-165-153
 OsREG527CCCACCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG436    CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501     CACCTGTC PPDB Motif  PLACE Motif 
REGCGCGACGCG+1013312810133136-134-126
 OsREG556CGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG PPDB Motif  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.