version
PlantPromoterDB promoter information of 011-058-E11

Summary of Gene (011-058-E11)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0606900        NCBI 
Gene model 011-058-E11  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 25598655-25597456)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
011-058-E11                      5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 011-058-E11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-25597219-14

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATATACCC-2559724825597257-43-52
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTGGGCCCCACCTGTCGGTGGGCCGTGG-2559731325597341-108-136
 OsREG628GGTGGGCC         GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC                    PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC                  PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC                 PPDB Motif  PLACE Motif 
 OsREG514       CCCACCTG               PPDB MotifGCCCA  PLACE Motif 
 OsREG436        CCACCTGT              PPDB Motif  PLACE Motif 
 OsREG501         CACCTGTC             PPDB Motif  PLACE Motif 
 OsREG564                  GTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG445                   TGGGCCGT   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504                    GGGCCGTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG521                     GGCCGTGG PPDB Motif  PLACE Motif 
REGGAGGCCCACCT-2559740225597412-197-207
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476   GCCCACCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.