version
PlantPromoterDB promoter information of 011-060-B02

Summary of Gene (011-060-B02)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0913800        NCBI 
Gene model 011-060-B02  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 41579800-41580999)

Genome position     
from initiation codon
016-088-H02         
TSS from cDNA
TSS information
011-060-B02                      5'->3' (+)
Promoter sequence








 
AK065343            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 011-060-B02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+41580780-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACTGGGCCCACCA+4158065641580669-144-131
 OsREG425AACTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599      GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGAGGTGGGCTGA+4158069241580702-108-98
 OsREG476AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG462 GGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG657   TGGGCTGA PPDB MotifGCCCA  PLACE Motif 
REGGTCGAGTC+4158070841580715-92-85
 OsREG586GTCGAGTC PPDB Motif  PLACE Motif 
REGATTGGGCCGGGCCGA+4158072541580739-75-61
 OsREG492ATTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG563 TTGGGCCG       PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG538   GGGCCGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG614    GGCCGGGC    PPDB Motif  PLACE Motif 
 OsREG616     GCCGGGCC   PPDB Motif  PLACE Motif 
 OsREG544      CCGGGCCG  PPDB Motif  PLACE Motif 
 OsREG568       CGGGCCGA PPDB MotifACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.