version
PlantPromoterDB promoter information of 011-061-F11

Summary of Gene (011-061-F11)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0656400        NCBI 
Gene model 011-061-F11  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 7: 28280134-28281333)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
011-061-F11                      5'->3' (+)
Promoter sequence










 
                    
Os07g0656300        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 011-061-F11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+28280949-185

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCTCTCTCT+2828092728280938-207-196
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAGTGGG+2828073928280746-395-388
 OsREG498CAAGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCAACGGCCCATA+2828084528280856-289-278
 OsREG494CAACGGCC     PPDB MotifCCAACGG  PLACE Motif 
 OsREG423 AACGGCCC    PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445  ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490   CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG630    GGCCCATA PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCATCAAGGCCCATAAAGGCCCATGA+2828087428280905-260-229
 OsREG504CACGGCCC                         PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA                        PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT                       PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG607    GCCCATCA                     PPDB MotifGCCCA  PLACE Motif 
 OsREG497          CAAGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG430           AAGGCCCA  AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474            AGGCCCAT  AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630             GGCCCATA            PPDB MotifGCCCA  PLACE Motif 
 OsREG605              GCCCATAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG517                       GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609                        GCCCATGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.