version
PlantPromoterDB promoter information of 011-074-D07

Summary of Gene (011-074-D07)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0550300        NCBI 
Gene model 011-074-D07  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 22259216-22258017)

Genome position     
from initiation codon
006-023-C12         
006-081-F12         
006-099-G06         
006-114-A02         
006-115-F05         
006-117-A04         
011-003-H03         
011-025-B09         
011-069-B06         
012-029-E03         
012-050-F04         
012-072-D11         
013-093-E04         
015-070-C10         
015-089-A01         
015-095-H06         
016-014-H08         
016-056-E07         
016-089-A01         
AK061870            
AK067529            
AK106151            
J013039D11          
J013050K19          
J013069F08          
J013108E24          
J013132D19          
J023039B18          
J023088C10          
J023121E18          
J023121M13          
J033034I21          
J033118N14          
J033125F23          
J033150M22          
J043004F18          
J043005J04          
J043020E12          
J065063C02          
J065102D15          
J065200P03          
J065208C22          
J065215B03          
J075013N21          
J075024P21          
J075027L19          
J075037F12          
J075084P15          
J075086M06          
J075116A02          
J075136P18          
J075181A01          
J075198O11          
J080002B20          
J080003E05          
J080005A18          
J080005E02          
J080005O18          
J080007B04          
J080007L18          
J080008C17          
J080011I03          
J080014B07          
J080014B09          
J080015A11          
J080016B07          
J080017H23          
J080020G09          
J080020I23          
J080021E15          
J080023O13          
J080024H17          
J080029P12          
J080030A15          
J080032I03          
J080032P18          
J080034E10          
J080038I23          
J080040B22          
J080040M13          
J080041E07          
J080042C08          
J080042H08          
J080043H10          
J080046J02          
J080050D12          
J080052C17          
J080054A05          
J080054J23          
J080056A15          
J080056F18          
J080059P07          
J080063J18          
J080066F15          
J080067G12          
J080070G15          
J080071B08          
J080071M08          
J080071N03          
J080074C01          
J080076F22          
J080076N23          
J080077F23          
J080077P10          
J080078A19          
J080078H07          
J080079G16          
J080079N23          
J080084L04          
J080084N12          
J080084N17          
J080086H08          
J080088M01          
J080090M14          
J080092F06          
J080095B14          
J080095C09          
J080095F20          
J080095H12          
J080096H22          
J090010O21          
J090012K22          
J090051I21          
J090065G14          
J090077H03          
J100035M10          
J100049C19          
J100051K11          
J100064C12          
J100064F13          
J100084H08          
TSS from cDNA
TSS information
011-074-D07                      5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 011-074-D07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-22259103-887

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCT-2225914622259153-930-937
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGAGCCGAGCCGCGTCGC-2225915922259177-943-961
 OsREG540CCGAGCCGAGCCG       PPDB Motif  PLACE Motif 
 OsREG559           CGCGTCGC PPDB Motif  PLACE MotifCGACG 
REGGGACGCGT-2225930922259316-1093-1100
 OsREG442GGACGCGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.