version
PlantPromoterDB promoter information of 011-076-D06

Summary of Gene (011-076-D06)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0349800        NCBI 
Gene model 011-076-D06  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 16498201-16497002)

Genome position     
from initiation codon
014-037-D12         
AK063677            
J053027D20          
J053039D11          
J053047P16          
J053048F05          
J053058E11          
J053060C03          
J053082N12          
J065017B15          
J065117G02          
J065212K21          
J075001H18          
J075003F20          
J075026F11          
J075035F13          
J075055C12          
J075067L20          
J075067O13          
J075070A12          
J075089E05          
J075128J17          
J075134M19          
J075192L11          
J075199D14          
TSS from cDNA
TSS information
011-076-D06                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 011-076-D06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-16497306-105

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGCCTATAAGA-1649733916497349-138-148
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGAGCCGTCCGCGTCGCCGCGCGACACGT-1649739916497428-198-227
 OsREG540CCGAGCCG                       PPDB Motif  PLACE Motif 
 OsREG468   AGCCGTCC                    PPDB Motif  PLACE Motif 
 OsREG562    GCCGTCCG                   PPDB Motif  PLACE Motif 
 OsREG559          CGCGTCGC             PPDB Motif  PLACE MotifCGACG 
 OsREG557                  CGCGCGAC     PPDB MotifACGCGC  PLACE Motif 
 OsREG452                      CGACACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGACGTGTCG-1649747816497485-277-284
 OsREG452ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGCACGCG-1649754016497547-339-346
 OsREG555CGCACGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.