version
PlantPromoterDB promoter information of 012-007-C01

Summary of Gene (012-007-C01)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0715400        NCBI 
Gene model 012-007-C01  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 31243666-31244865)

Genome position     
from initiation codon
011-088-B12         
012-038-G03         
AK071262            
AK073963            
J023085J06          
J033073I09          
J080316N15          
J090062N15          
TSS from cDNA
TSS information
012-007-C01                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 012-007-C01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+31244353-313
TSS clone peakGclone+31244354-312

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAGCCCAG+3124420931244218-457-448
 OsREG419AAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG428  AAGCCCAG PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCAAGGCCCATAC+3124422131244238-445-428
 OsREG587GAGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG497      CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430       AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474        AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630         GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606          GCCCATAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATAAGCA-3124368931243697AK121369, J023125K15
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.