PlantPromoterDB promoter information of 012-063-F11

Summary of Gene (012-063-F11)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0190900        NCBI 
Gene model 012-063-F11  
Description NONE  


Focused view (chromosome 7: 4923132-4921933)

Genome position     
from initiation codon
TSS from cDNA
TSS information
012-063-F11                      5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


Promoter Summary of 012-063-F11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakAclone-4922238-106

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 OsREG629TCTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG            PPDB MotifGCCCA  PLACE Motif 
 OsREG423   GGGCCGTT          PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG420    GGCCGTTT         PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG593        GTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG625         TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563          TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658           TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG642            GGGCCGAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakGclone+4922425AK071379, AK071379, AK103440

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGCCCACCAC+49221554922162AK071379, AK103440
REGCTCTCCGC+49221894922196AK071379, AK103440
REGCGGACGGC+49222014922208AK071379, AK103440
REGTGATGGGC+49222354922242AK071379, AK103440
REGCTCCCCCA+49222564922263AK071379, AK103440
REGTTGGCCCAGA+49222684922277AK071379, AK103440
REGACCCCCCA+49222914922298AK071379, AK103440
REGTAGGCCCAATT+49223064922316AK071379, AK103440
REGTTCGGCCCAAACGGCCCAGA+49223234922342AK071379, AK103440
 OsREG642TTCGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG593    GCCCAAAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG420        AAACGGCC     PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG423         AACGGCCC    PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG565           CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629            GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGTTGGTGG+49223534922360AK071379, AK103440

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.