version
PlantPromoterDB promoter information of 012-087-D12

Summary of Gene (012-087-D12)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0737900        NCBI 
Gene model 012-087-D12  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 32534392-32535591)

Genome position     
from initiation codon
AK072600            
J023006E12          
J023130A18          
J023134O05          
TSS from cDNA
TSS information
012-087-D12                      5'->3' (+)
Promoter sequence







 
AK071486            
AK073299            
J065112P14          
J075118K01          
J075118M01          
J100041K07          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 012-087-D12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+32535239-153

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCATGGGC+3253498832534995-404-397
 OsREG525CCATGGGC PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTTGTGGGCCCC+3253511532535125-277-267
 OsREG597TTGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGGGGAAAGC+3253513432535141-258-251
 OsREG621GGGAAAGC PPDB Motif  PLACE Motif 
REGAAGGCCCATTGGGCCTT+3253516032535176-232-216
 OsREG430AAGGCCCA TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT         PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT        PPDB MotifGCCCA  PLACE Motif 
 OsREG492       ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471        TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCCTA+3253518232535192-210-200
 OsREG493ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.