version
PlantPromoterDB promoter information of 014-013-F08

Summary of Gene (014-013-F08)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0454300        NCBI 
Gene model 014-013-F08  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 17171036-17169837)

Genome position     
from initiation codon
011-073-B07         
011-089-D03         
012-041-B07         
012-042-D12         
012-046-G11         
012-072-D10         
012-090-F06         
013-009-A10         
013-096-B03         
014-002-F10         
014-006-A10         
014-006-C05         
014-006-E01         
014-006-H04         
014-009-D05         
014-010-D07         
014-012-A10         
014-014-D01         
014-016-D07         
014-020-F09         
014-023-C07         
014-024-A03         
014-025-D11         
014-027-D02         
014-030-F11         
014-032-H06         
014-034-D06         
014-037-E04         
014-038-C02         
014-041-B08         
014-044-A10         
014-045-C11         
014-046-B04         
014-047-D01         
014-053-C03         
014-053-C09         
014-072-D09         
014-073-D09         
014-073-F01         
014-081-B04         
014-081-G07         
014-084-C10         
014-084-F03         
014-085-D08         
014-087-H10         
014-095-E02         
014-095-G07         
AK121952            
J033107K14          
J065021B08          
J065059D24          
J065066D13          
J065070K11          
J065081I18          
J065120F19          
J065186M13          
J075031E22          
J075046F04          
J075069L13          
J075097G09          
J075099C23          
J075149N21          
J075150G23          
J075170K09          
J075173A09          
J075177C21          
TSS from cDNA
TSS information
014-013-F08                      5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 014-013-F08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-17170127-91

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTATAAATG-1717015117170160-115-124
Y PatchCCTCCTCC-1717016317170170-127-134
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGTCTC-1717021717170224-181-188
 OsREG506CACGTCTC PPDB MotifACGT  PLACE Motif 
REGTCCACGCC-1717025417170261-218-225
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGGGACACGT-1717027217170279-236-243
 OsREG451GGACACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGACGTGGCG-1717030117170308-265-272
 OsREG448ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCTCGCCC-1717031717170324-281-288
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.